| Detail of EST/Unigene TCHL59112 |
| Acc. | TCHL59112 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Long chain acyl-CoA synthetase 2 OS=Arabidopsis thaliana E-value=7e-84; Long chain acyl-CoA synthetase 5 OS=Arabidopsis thaliana E-value=5e-73; Long chain acyl-CoA synthetase 3 OS=Arabidopsis thaliana E-value=2e-72; Long chain acyl-CoA synthetase 4 OS=Arabidopsis thaliana E-value=2e-72; Long chain acyl-CoA synthetase 1 OS=Arabidopsis thaliana E-value=3e-57; |
| Length | 938 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168 (11 ESTs); SRR546165 (8 ESTs); SRR546172 (7 ESTs); SRR546170 (1 ESTs); |
| Sequence | CTTATTTAAATTTATCTTACAAAAATATTAATAATGTAATACATAGAATATTGTAGAAGA |
| EST members of Unigene | SRR546168.10258 SRR546172.40243 SRR546168.96192 SRR546170.65265 SRR546165.304693 SRR546172.106172 SRR546172.50133 SRR546168.105714 SRR546165.291427 SRR546172.61160 SRR546165.28239 SRR546168.86809 SRR546165.160919 SRR546165.112403 SRR546168.21391 SRR546172.88620 SRR546168.111368 SRR546165.53420 SRR546165.310634 SRR546172.42111 SRR546168.77792 SRR546165.79721 SRR546168.48620 SRR546168.72388 SRR546168.8441 SRR546172.60676 SRR546168.70657 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase |
| EC | 6.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841367 |
| Trichome-related Gene from Literature | 841367 |