| Detail of EST/Unigene TCHL59484 |
| Acc. | TCHL59484 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Steroid 5-alpha-reductase DET2 OS=Gossypium hirsutum E-value=2e-98; Steroid 5-alpha-reductase DET2 OS=Arabidopsis thaliana E-value=5e-97; Steroid 5-alpha-reductase DET2 OS=Solanum lycopersicum E-value=4e-81; 3-oxo-5-alpha-steroid 4-dehydrogenase 1 OS=Rattus norvegicus E-value=4e-40; 3-oxo-5-alpha-steroid 4-dehydrogenase 1 OS=Mus musculus E-value=4e-40; |
| Length | 902 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172 (13 ESTs); SRR546165 (7 ESTs); SRR546170 (4 ESTs); SRR546168 (3 ESTs); HL_CDS (1 ESTs); |
| Sequence | TAATCTCATTTTTCAGGTCAATTTTACTTTTCCTCTGTTCCAAAAATGGAGTCTGATGAT |
| EST members of Unigene | SRR546172.47790 SRR546172.95908 SRR546165.146851 SRR546170.137140 SRR546165.23334 SRR546172.67896 SRR546172.137654 SRR546172.87028 SRR546168.79829 SRR546170.92567 SRR546172.10904 SRR546172.27157 SRR546165.12011 SRR546172.86590 SRR546168.21592 SRR546165.117148 SRR546165.25177 SRR546165.35623 SRR546170.58055 SRR546165.311785 SRR546170.33524 SRR546172.85958 SRR546172.101817 AY772257 SRR546172.44254 SRR546172.36328 SRR546172.140474 SRR546168.124548 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.3.99.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818383 |
| Trichome-related Gene from Literature | 818383 |