Detail of EST/Unigene TCHL59561 |
Acc. | TCHL59561 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RAC2 OS=Lotus japonicus E-value=7e-97; Rac-like GTP-binding protein RAC13 OS=Gossypium hirsutum E-value=2e-92; Rac-like GTP-binding protein 5 OS=Oryza sativa subsp. japonica E-value=5e-92; Rac-like GTP-binding protein ARAC4 OS=Arabidopsis thaliana E-value=9e-92; Rac-like GTP-binding protein ARAC5 OS=Arabidopsis thaliana E-value=2e-91; |
Length | 897 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168 (10 ESTs); SRR546170 (5 ESTs); SRR546172 (4 ESTs); SRR546165 (2 ESTs); |
Sequence | TGCTTATTTGCTATTTTTTTTTCATGACCAAGATTACAATATGTAAACTTACAATAGATT |
EST members of Unigene | SRR546170.95070 SRR546170.126374 SRR546170.36350 SRR546168.81770 SRR546168.116160 SRR546170.6019 SRR546168.64577 SRR546168.29807 SRR546172.114509 SRR546168.90259 SRR546172.167204 SRR546172.75802 SRR546168.43573 SRR546168.27170 SRR546168.5730 SRR546168.88662 SRR546165.213109 SRR546170.158016 SRR546172.131068 SRR546165.212545 SRR546168.62213 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
Probeset |
|
Corresponding NCBI Gene | 838598 |
Trichome-related Gene from Literature | 838598 |