Detail of EST/Unigene TCHL59750 |
Acc. | TCHL59750 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Auxin-induced protein AUX22 OS=Glycine max E-value=4e-59; Auxin-induced protein 22A OS=Vigna radiata var. radiata E-value=6e-58; Auxin-induced protein 22C OS=Vigna radiata var. radiata E-value=2e-57; Auxin-induced protein IAA6 OS=Pisum sativum E-value=1e-55; Auxin-responsive protein IAA19 OS=Arabidopsis thaliana E-value=2e-51; |
Length | 880 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546172 (21 ESTs); SRR546165 (2 ESTs); |
Sequence | AAAGATTAGTGCTCTAATATATAGTATTATTATTATCGATCATCAATAATATTATTGTTA |
EST members of Unigene | SRR546172.71932 SRR546172.102288 SRR546172.151753 SRR546172.123563 SRR546172.163942 SRR546172.130523 SRR546172.102895 SRR546172.9174 SRR546172.95376 SRR546172.80302 SRR546172.61883 SRR546172.156942 SRR546172.96265 SRR546172.162832 SRR546172.29315 SRR546172.124390 SRR546172.32799 SRR546165.154482 SRR546172.144893 SRR546165.298487 SRR546172.135660 SRR546172.116735 SRR546172.52581 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | ARF |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820793 |
Trichome-related Gene from Literature | 820793 |