| Detail of EST/Unigene TCHL59885 |
| Acc. | TCHL59885 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Transcription factor TT8 OS=Arabidopsis thaliana E-value=4e-13; |
| Length | 868 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (8 ESTs); SRR546172 (6 ESTs); HLUTR3CH (4 ESTs); SRR546168 (3 ESTs); |
| Sequence | ACTCTAGCCATGCTAAGAACAACCTACACTTACAATTACCATCCATAAAATGTTTGAAGT |
| EST members of Unigene | SRR546172.98763 SRR546168.29951 GD252644 SRR546172.12443 SRR546172.166845 SRR546165.142826 SRR546172.44344 SRR546165.211428 SRR546172.127446 SRR546165.251510 SRR546172.72626 SRR546168.22514 SRR546165.198325 SRR546165.65759 SRR546165.295721 GD251034 SRR546165.155629 GD252585 SRR546165.174572 GD249007 SRR546168.32948 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | bHLH |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826571 |
| Trichome-related Gene from Literature | 826571 |