| Detail of EST/Unigene TCHL60379 |
| Acc. | TCHL60379 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Histone-lysine N-methyltransferase ASHH2 OS=Arabidopsis thaliana E-value=5e-14; |
| Length | 830 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546172 (15 ESTs); SRR546165 (3 ESTs); SRR546170 (2 ESTs); SRR546168 (1 ESTs); |
| Sequence | ACGAACAGAGAGGACAAAGATGTTTCTGGCTGCACAAATGATCAATATCAGCTTGATAAA |
| EST members of Unigene | SRR546172.15874 SRR546172.4867 SRR546168.29754 SRR546172.4301 SRR546165.77870 SRR546170.56040 SRR546165.71699 SRR546172.2579 SRR546172.1637 SRR546172.7362 SRR546172.120029 SRR546172.11223 SRR546165.179378 SRR546170.164492 SRR546172.137525 SRR546172.52724 SRR546172.21634 SRR546172.122914 SRR546172.59727 SRR546172.51038 SRR546172.1937 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844066 |
| Trichome-related Gene from Literature | 844066 |