| Detail of EST/Unigene TCHL60408 |
| Acc. | TCHL60408 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=4e-76; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=1e-70; Glutathione S-transferase OS=Hyoscyamus muticus E-value=3e-70; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=9e-70; Glutathione S-transferase OS=Silene vulgaris E-value=4e-68; |
| Length | 828 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (9 ESTs); SRR546170 (9 ESTs); SRR546172 (4 ESTs); SRR546168 (1 ESTs); |
| Sequence | ATTTGATTTGTTTGACCATCAATTATTTAGATCAGTCTGTTTGTTAGATAGATTTCTAAC |
| EST members of Unigene | SRR546165.221433 SRR546165.12915 SRR546165.98918 SRR546170.39410 SRR546170.68780 SRR546172.158512 SRR546165.63760 SRR546165.21846 SRR546165.161761 SRR546172.62334 SRR546170.10400 SRR546168.3452 SRR546170.124949 SRR546170.22459 SRR546170.155972 SRR546170.37572 SRR546170.61919 SRR546172.117461 SRR546165.51316 SRR546170.13642 SRR546172.158055 SRR546165.45916 SRR546165.189702 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819386 |
| Trichome-related Gene from Literature | 819386 |