| Detail of EST/Unigene TCHL60549 |
| Acc. | TCHL60549 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ZF-HD homeobox protein At4g24660 OS=Arabidopsis thaliana E-value=2e-19; Transcription factor HB29 OS=Arabidopsis thaliana E-value=9e-19; ZF-HD homeobox protein At5g65410 OS=Arabidopsis thaliana E-value=6e-18; |
| Length | 815 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (25 ESTs); SRR546168 (11 ESTs); SRR546172 (9 ESTs); |
| Sequence | AATGGCTCCCATGTTATATCCTCAACAAAGTGATGATCTCATTAATTAAAACTCTAAACA |
| EST members of Unigene | SRR546165.37673 SRR546165.108195 SRR546168.85593 SRR546165.293514 SRR546165.3813 SRR546165.36109 SRR546165.128474 SRR546168.77267 SRR546165.267616 SRR546168.12180 SRR546172.145571 SRR546168.48318 SRR546165.96853 SRR546165.60894 SRR546168.118291 SRR546168.94513 SRR546165.51798 SRR546168.60891 SRR546172.111767 SRR546165.86379 SRR546165.130244 SRR546165.28369 SRR546165.49806 SRR546165.203923 SRR546165.292472 SRR546168.64647 SRR546165.245902 SRR546172.78225 SRR546172.52130 SRR546165.263667 SRR546168.17282 SRR546168.97848 SRR546165.11268 SRR546165.258858 SRR546165.19039 SRR546172.59156 SRR546168.112223 SRR546165.99854 SRR546172.137600 SRR546172.27648 SRR546165.291156 SRR546172.166949 SRR546172.78444 SRR546165.306594 SRR546165.147363 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | ZF-HD |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 833972 |
| Trichome-related Gene from Literature | 833972 |