| Detail of EST/Unigene TCHL61118 |
| Acc. | TCHL61118 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin-related protein 2/3 complex subunit 4 OS=Dictyostelium discoideum E-value=2e-62; Actin-related protein 2/3 complex subunit 4 OS=Mus musculus E-value=9e-60; Actin-related protein 2/3 complex subunit 4 OS=Homo sapiens E-value=9e-60; Actin-related protein 2/3 complex subunit 4 OS=Bos taurus E-value=9e-60; Probable actin-related protein 2/3 complex subunit 4 OS=Caenorhabditis elegans E-value=6e-53; |
| Length | 765 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (9 ESTs); SRR546168 (7 ESTs); SRR546172 (6 ESTs); SRR546170 (3 ESTs); |
| Sequence | GCCGATCGTCTTCAACAAAAGGCGCATTTTAGCGGTTTCACTGAACAGCACAAAGCGCAC |
| EST members of Unigene | SRR546165.277222 SRR546172.114616 SRR546170.24887 SRR546165.55814 SRR546168.55254 SRR546172.415 SRR546165.184729 SRR546165.187629 SRR546165.52954 SRR546165.247568 SRR546172.1440 SRR546168.57895 SRR546168.15965 SRR546170.36820 SRR546168.110775 SRR546172.41673 SRR546170.81203 SRR546168.13402 SRR546172.169593 SRR546165.104019 SRR546165.110221 SRR546168.82791 SRR546172.114166 SRR546165.305228 SRR546168.50738 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 3770404 |
| Trichome-related Gene from Literature | 3770404 |