| Detail of EST/Unigene TCHL61294 |
| Acc. | TCHL61294 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Delta(24)-sterol reductase OS=Pisum sativum E-value=1e-72; Delta(24)-sterol reductase OS=Arabidopsis thaliana E-value=4e-64; Delta(24)-sterol reductase OS=Rattus norvegicus E-value=8e-11; Delta(24)-sterol reductase OS=Mus musculus E-value=8e-11; Delta(24)-sterol reductase OS=Macaca fascicularis E-value=1e-10; |
| Length | 753 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170 (11 ESTs); SRR546168 (10 ESTs); SRR546172 (8 ESTs); SRR546165 (4 ESTs); |
| Sequence | CGGCTGTTTAGCAAATTGGGGCATCATTAAACTAAGTTCGGTCACTTTAAATAAAATTGG |
| EST members of Unigene | SRR546170.25072 SRR546172.74611 SRR546168.73774 SRR546170.86887 SRR546168.113370 SRR546172.109190 SRR546165.276108 SRR546168.128666 SRR546170.42481 SRR546170.100245 SRR546170.120921 SRR546168.113825 SRR546168.102623 SRR546168.89874 SRR546168.115959 SRR546170.62920 SRR546165.308340 SRR546170.85711 SRR546172.64470 SRR546172.108724 SRR546170.164868 SRR546165.295132 SRR546172.149883 SRR546168.34089 SRR546168.85875 SRR546168.116991 SRR546170.163744 SRR546172.135834 SRR546172.146072 SRR546170.32565 SRR546165.100964 SRR546172.146635 SRR546170.15549 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K09828 delta24-sterol reductase |
| EC | 1.3.1.- 1.3.1.72 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821519 |
| Trichome-related Gene from Literature | 821519 |