| Detail of EST/Unigene TCHL61602 |
| Acc. | TCHL61602 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Pattern formation protein EMB30 OS=Arabidopsis thaliana E-value=2e-54; Golgi-specific brefeldin A-resistance guanine nucleotide exchange factor 1 OS=Cricetulus griseus E-value=1e-15; Golgi-specific brefeldin A-resistance guanine nucleotide exchange factor 1 OS=Homo sapiens E-value=4e-14; |
| Length | 722 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170 (11 ESTs); SRR546165 (6 ESTs); SRR546172 (3 ESTs); SRR546168 (2 ESTs); |
| Sequence | TCACTCATTTCAGACATCATCGCCGCCGCCGCCGCCGCCACCCCCCCCTCTTTTCCCGCT |
| EST members of Unigene | SRR546165.273620 SRR546168.54100 SRR546170.108379 SRR546170.113616 SRR546165.177209 SRR546165.269787 SRR546168.115786 SRR546172.159717 SRR546165.110959 SRR546170.121768 SRR546170.103737 SRR546165.164626 SRR546170.120423 SRR546170.128735 SRR546172.159933 SRR546172.133860 SRR546170.156191 SRR546170.150650 SRR546170.130943 SRR546165.114151 SRR546170.100622 SRR546170.151255 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837958 |
| Trichome-related Gene from Literature | 837958 |