Detail of EST/Unigene TCHL61837 |
Acc. | TCHL61837 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable WRKY transcription factor 70 OS=Arabidopsis thaliana E-value=1e-21; Probable WRKY transcription factor 54 OS=Arabidopsis thaliana E-value=2e-17; Probable WRKY transcription factor 46 OS=Arabidopsis thaliana E-value=3e-17; Probable WRKY transcription factor 30 OS=Arabidopsis thaliana E-value=3e-15; Probable WRKY transcription factor 67 OS=Arabidopsis thaliana E-value=6e-15; |
Length | 697 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546170 (18 ESTs); SRR546172 (6 ESTs); SRR546165 (2 ESTs); SRR546168 (1 ESTs); |
Sequence | TCTCACACAATGAAAAGAGAGACCTCAACTCTGATTGATGATGGGCATGCATGGAGAAAA |
EST members of Unigene | SRR546172.163532 SRR546172.1969 SRR546170.46555 SRR546170.25676 SRR546170.47706 SRR546172.130110 SRR546165.199809 SRR546168.132389 SRR546170.149765 SRR546170.143391 SRR546170.63025 SRR546170.54334 SRR546172.119452 SRR546170.61592 SRR546170.56563 SRR546170.108439 SRR546170.45468 SRR546170.4509 SRR546170.72156 SRR546170.53226 SRR546170.112552 SRR546172.112454 SRR546172.70151 SRR546165.37231 SRR546170.131110 SRR546170.48813 SRR546170.113720 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824807 |
Trichome-related Gene from Literature | 824807 |