Detail of EST/Unigene TCHL61937 |
Acc. | TCHL61937 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Gibberellin-regulated protein 4 OS=Arabidopsis thaliana E-value=8e-38; Gibberellin-regulated protein 6 OS=Arabidopsis thaliana E-value=1e-34; Gibberellin-regulated protein 5 OS=Arabidopsis thaliana E-value=1e-26; Gibberellin-regulated protein 12 OS=Arabidopsis thaliana E-value=3e-26; Protein GAST1 OS=Solanum lycopersicum E-value=1e-25; |
Length | 693 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168 (21 ESTs); SRR546172 (19 ESTs); SRR546170 (2 ESTs); |
Sequence | TATACCCAACACACTCACAAATCTGGATCAAACCCTTCTTCTCTCCTCACTTTCATTGTG |
EST members of Unigene | SRR546172.144609 SRR546168.79423 SRR546172.133402 SRR546168.105696 SRR546168.124634 SRR546172.66922 SRR546168.60864 SRR546168.94676 SRR546172.153481 SRR546168.134884 SRR546170.11211 SRR546172.138666 SRR546168.115969 SRR546168.26120 SRR546168.42153 SRR546172.48592 SRR546168.95472 SRR546172.67907 SRR546168.21466 SRR546168.25519 SRR546172.149031 SRR546172.58012 SRR546168.116407 SRR546168.104814 SRR546168.87425 SRR546168.73317 SRR546172.6697 SRR546168.1426 SRR546168.135711 SRR546170.121388 SRR546172.85721 SRR546172.61814 SRR546172.45391 SRR546168.52727 SRR546172.115400 SRR546172.96073 SRR546172.23787 SRR546172.157300 SRR546172.68407 SRR546172.88683 SRR546168.67552 SRR546168.29877 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831375 |
Trichome-related Gene from Literature | 831375 |