| Detail of EST/Unigene TCHL62210 |
| Acc. | TCHL62210 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Calcium-binding protein PBP1 OS=Arabidopsis thaliana E-value=5e-32; Calcium-binding protein KIC OS=Arabidopsis thaliana E-value=1e-30; Caltractin (Fragment) OS=Tetraselmis striata E-value=6e-09; Caltractin OS=Scherffelia dubia E-value=6e-09; Caltractin (Fragment) OS=Spermatozopsis similis E-value=1e-08; |
| Length | 664 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546170 (16 ESTs); SRR546165 (2 ESTs); SRR546172 (1 ESTs); |
| Sequence | TCATTATAAACAACGGCATTACAATCAACGAATATACAATAAAGTTATTTTTATTCAATG |
| EST members of Unigene | SRR546170.110900 SRR546170.139101 SRR546170.54683 SRR546170.39049 SRR546170.58564 SRR546170.96431 SRR546170.86775 SRR546165.270191 SRR546170.140058 SRR546170.67028 SRR546165.41876 SRR546170.78882 SRR546170.143034 SRR546170.80256 SRR546170.116397 SRR546170.23663 SRR546170.119881 SRR546172.29743 SRR546170.146386 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K02183 calmodulin; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K02183 calmodulin; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10840 centrin-2 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.1 Polysaccharide transporter PST; 9.A.14 Nuclear pore complex NPC |
| Probeset |
|
| Corresponding NCBI Gene | 828836 |
| Trichome-related Gene from Literature | 828836 |