Detail of EST/Unigene TCHL62437 |
Acc. | TCHL62437 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 646 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546168 (12 ESTs); SRR546172 (7 ESTs); SRR546165 (1 ESTs); |
Sequence | ATCCTTGATAATGATGATACTATAACAAGTTCTTCTGGAACTAATATATCTCAAGAACAT |
EST members of Unigene | SRR546168.47907 SRR546172.124699 SRR546172.119101 SRR546168.92755 SRR546168.110918 SRR546168.122711 SRR546168.110546 SRR546168.58968 SRR546168.42749 SRR546172.156753 SRR546165.245963 SRR546172.102933 SRR546168.104416 SRR546168.44910 SRR546172.67976 SRR546172.23149 SRR546168.126289 SRR546168.89978 SRR546172.87729 SRR546168.106406 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818884 |
Trichome-related Gene from Literature | 818884 |