Detail of EST/Unigene TCHL63218 |
Acc. | TCHL63218 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable inactive receptor kinase RLK902 OS=Arabidopsis thaliana E-value=1e-76; Probable inactive receptor kinase At1g48480 OS=Arabidopsis thaliana E-value=3e-74; Probable inactive receptor kinase At3g02880 OS=Arabidopsis thaliana E-value=2e-71; Probable inactive receptor kinase At5g16590 OS=Arabidopsis thaliana E-value=7e-71; Probable inactive receptor kinase At2g26730 OS=Arabidopsis thaliana E-value=5e-66; |
Length | 570 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (7 ESTs); SRR546172 (4 ESTs); SRR546170 (2 ESTs); SRR546168 (1 ESTs); |
Sequence | GGTTCTACTCAGGGCTTATTACTTTAGCAGAGATGAAAAGCTTCTTGTTTATGATTACAT |
EST members of Unigene | SRR546165.191108 SRR546172.157361 SRR546172.168018 SRR546165.28637 SRR546165.224597 SRR546172.48235 SRR546170.103145 SRR546165.249435 SRR546165.213972 SRR546165.144233 SRR546168.1653 SRR546165.159334 SRR546170.40911 SRR546172.76932 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.7.11.1 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 821053 |
Trichome-related Gene from Literature | 821053 |