| Detail of EST/Unigene TCHL63852 |
| Acc. | TCHL63852 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 503 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (11 ESTs); SRR546168 (1 ESTs); |
| Sequence | ACGACAACTAAGGGGAGATCCGAAGTTTGAGTTCAAAAGTTTGGAATCCCTCTCTCCTTC |
| EST members of Unigene | SRR546165.304527 SRR546168.131778 SRR546165.316539 SRR546165.69005 SRR546165.56074 SRR546165.298905 SRR546165.197428 SRR546165.84893 SRR546165.260173 SRR546165.40074 SRR546165.279723 SRR546165.171917 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839965 |
| Trichome-related Gene from Literature | 839965 |