Detail of EST/Unigene TCHL63852 |
Acc. | TCHL63852 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 503 nt |
Species | Humulus lupulus |
Belonged EST Libraries | SRR546165 (11 ESTs); SRR546168 (1 ESTs); |
Sequence | ACGACAACTAAGGGGAGATCCGAAGTTTGAGTTCAAAAGTTTGGAATCCCTCTCTCCTTC |
EST members of Unigene | SRR546165.304527 SRR546168.131778 SRR546165.316539 SRR546165.69005 SRR546165.56074 SRR546165.298905 SRR546165.197428 SRR546165.84893 SRR546165.260173 SRR546165.40074 SRR546165.279723 SRR546165.171917 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839965 |
Trichome-related Gene from Literature | 839965 |