| Detail of EST/Unigene TCHL63858 |
| Acc. | TCHL63858 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 502 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546168 (16 ESTs); SRR546165 (7 ESTs); SRR546170 (6 ESTs); |
| Sequence | AAGAAGATCAATGGAAAGTCACAATTCAGATAAACCATGATCCTTGGTCCTCACTAAAAA |
| EST members of Unigene | SRR546168.83281 SRR546168.38842 SRR546168.74978 SRR546168.44455 SRR546170.96993 SRR546168.5043 SRR546165.246978 SRR546168.41760 SRR546170.161946 SRR546168.68832 SRR546170.109973 SRR546165.229228 SRR546168.12032 SRR546170.31683 SRR546165.225297 SRR546168.11382 SRR546168.21908 SRR546168.116971 SRR546165.295529 SRR546168.50522 SRR546165.177669 SRR546168.21938 SRR546168.111598 SRR546170.119512 SRR546168.128856 SRR546165.50389 SRR546170.111799 SRR546168.35491 SRR546165.184467 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837958 |
| Trichome-related Gene from Literature | 837958 |