| Detail of EST/Unigene TCHL64534 |
| Acc. | TCHL64534 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cyclin-dependent kinase A-1 OS=Arabidopsis thaliana E-value=2e-10; Cell division control protein 2 homolog OS=Chenopodium rubrum E-value=2e-10; Cell division control protein 2 homolog OS=Vigna aconitifolia E-value=2e-10; Cell division control protein 2 homolog A OS=Antirrhinum majus E-value=2e-10; Cell division control protein 2 homolog 2 OS=Medicago sativa E-value=7e-10; |
| Length | 424 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | SRR546165 (20 ESTs); SRR546172 (1 ESTs); |
| Sequence | AAAGCTATAGTTTCATTAGTAACACGATCACGGGCCTTGTAAACCACACCATAGGTTCCT |
| EST members of Unigene | SRR546165.38049 SRR546165.82689 SRR546165.91787 SRR546165.126958 SRR546172.98053 SRR546165.16244 SRR546165.13546 SRR546165.60317 SRR546165.33091 SRR546165.16955 SRR546165.15020 SRR546165.159368 SRR546165.83344 SRR546165.54550 SRR546165.71949 SRR546165.38725 SRR546165.19201 SRR546165.126262 SRR546165.144050 SRR546165.204149 SRR546165.73940 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.7.1.- 2.7.11.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824036 |
| Trichome-related Gene from Literature | 824036 |