Detail of EST/Unigene TCMP40140 |
Acc. | TCMP40140 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=3e-72; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=1e-70; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=4e-70; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=6e-69; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=3e-50; |
Length | 752 nt |
Species | Mentha x piperita |
Belonged EST Libraries | MP_TRI (2 ESTs); |
Sequence | AAAAAGAAAAAGAGTGGGGCCTAGTTTGATAAGCCGAAATTTGGAGTCCCAAACAGCAAA |
EST members of Unigene | AW255903 AW255634 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820387 |
Trichome-related Gene from Literature | 820387 |