Detail of EST/Unigene TCMS40509 |
Acc. | TCMS40509 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-dependent 6'-deoxychalcone synthase OS=Glycine max E-value=0; Non-functional NADPH-dependent codeinone reductase 2 OS=Papaver somniferum E-value=1e-83; NADPH-dependent codeinone reductase 1-4 OS=Papaver somniferum E-value=7e-81; NADPH-dependent codeinone reductase 1-1 OS=Papaver somniferum E-value=7e-80; NADPH-dependent codeinone reductase 1-5 OS=Papaver somniferum E-value=2e-79; |
Length | 1249 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_CDS (5 ESTs); |
Sequence | AACTCACTCAAAGGGTAACAATCTTAACATTGAACCTTCCCAACCCAACAACAAAGAAAA |
EST members of Unigene | X82366 X82368 X82367 MSU13925 MSU13924 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+) |
EC | 1.1.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1878.1.S1_at, Msa.1879.1.S1_s_at, Mtr.17404.1.S1_s_at
|
Corresponding NCBI Gene | 842289 |
Trichome-related Gene from Literature | N/A |