Detail of EST/Unigene TCMT40446 |
Acc. | TCMT40446 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=3e-23; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-23; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-22; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=1e-22; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=5e-22; |
Length | 822 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT (2 ESTs); |
Sequence | TGATTACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | AW687039 AW687190 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40000.1.S1_at
|
Corresponding NCBI Gene | 830441 |
Trichome-related Gene from Literature | N/A |