| Detail of EST/Unigene TCMT40446 |
| Acc. | TCMT40446 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=3e-23; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-23; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-22; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=1e-22; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=5e-22; |
| Length | 822 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DROOT (2 ESTs); |
| Sequence | TGATTACGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
| EST members of Unigene | AW687039 AW687190 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40000.1.S1_at
|
| Corresponding NCBI Gene | 830441 |
| Trichome-related Gene from Literature | N/A |