Detail of EST/Unigene TCMT41537 |
Acc. | TCMT41537 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Triticum aestivum E-value=4e-56; Cysteine synthase OS=Spinacia oleracea E-value=6e-56; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=4e-55; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=3e-54; Cysteine synthase OS=Zea mays E-value=2e-53; |
Length | 639 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA (2 ESTs); |
Sequence | CTCCTATTTCTCATTGTTTTGTCTTTTATGTGAGATGTTATATATGGTTTTTAATAGCTT |
EST members of Unigene | BQ139984 BQ138199 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase |
EC | 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.8464.1.S1_s_at
|
Corresponding NCBI Gene | 825145 |
Trichome-related Gene from Literature | N/A |