| Detail of EST/Unigene TCMT41537 |
| Acc. | TCMT41537 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Triticum aestivum E-value=4e-56; Cysteine synthase OS=Spinacia oleracea E-value=6e-56; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=4e-55; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=3e-54; Cysteine synthase OS=Zea mays E-value=2e-53; |
| Length | 639 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_LEAF_PHOMA (2 ESTs); |
| Sequence | CTCCTATTTCTCATTGTTTTGTCTTTTATGTGAGATGTTATATATGGTTTTTAATAGCTT |
| EST members of Unigene | BQ139984 BQ138199 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase |
| EC | 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.8464.1.S1_s_at
|
| Corresponding NCBI Gene | 825145 |
| Trichome-related Gene from Literature | N/A |