Detail of EST/Unigene TCMT41620 |
Acc. | TCMT41620 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Arabidopsis thaliana E-value=8e-26; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Triticum aestivum E-value=4e-22; Sedoheptulose-1,7-bisphosphatase, chloroplastic OS=Spinacia oleracea E-value=2e-21; Beta-galactosidase OS=Escherichia coli O127:H6 (strain E2348/69 / EPEC) E-value=3e-17; Beta-galactosidase OS=Escherichia coli E-value=7e-17; |
Length | 1012 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (2 ESTs); |
Sequence | TGATTCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BQ144489 BQ144450 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K03841 fructose-1,6-bisphosphatase I; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K03841 fructose-1,6-bisphosphatase I |
EC | 3.1.3.11 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1851.1.S1_at
|
Corresponding NCBI Gene | 824746 |
Trichome-related Gene from Literature | N/A |