Detail of EST/Unigene TCMT42051 |
Acc. | TCMT42051 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-50; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-50; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-50; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-50; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=5e-50; |
Length | 791 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (2 ESTs); |
Sequence | TGCTTGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCC |
EST members of Unigene | BQ158729 BQ157939 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37209.1.S1_s_at
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |