Detail of EST/Unigene TCMT46182 |
Acc. | TCMT46182 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A1 OS=Persea americana E-value=2e-51; Cytochrome P450 71B14 OS=Arabidopsis thaliana E-value=3e-44; Cytochrome P450 71B13 OS=Arabidopsis thaliana E-value=5e-43; Cytochrome P450 71B25 OS=Arabidopsis thaliana E-value=1e-42; Cytochrome P450 71B3 OS=Arabidopsis thaliana E-value=2e-42; |
Length | 679 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD (2 ESTs); |
Sequence | GGAGGATAATGGCTCAAGTTTTAGATCTTAGTATAGGAGATTTGTTTCCTTTGTTGGGTT |
EST members of Unigene | BQ122624 BQ122446 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.39862.1.S1_at
|
Corresponding NCBI Gene | 832589 |
Trichome-related Gene from Literature | N/A |