Detail of EST/Unigene TCMT47240 |
Acc. | TCMT47240 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=0; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=0; |
Length | 855 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD (2 ESTs); |
Sequence | AACGTCATAGGACTCAAAACTGGGTAAGCAAAGCATATCATTGGAGCCTGGTGGACAAAT |
EST members of Unigene | CA989695 CA858026 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |