| Detail of EST/Unigene TCMT47240 |
| Acc. | TCMT47240 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=0; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=0; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=0; |
| Length | 855 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | GLSD (2 ESTs); |
| Sequence | AACGTCATAGGACTCAAAACTGGGTAAGCAAAGCATATCATTGGAGCCTGGTGGACAAAT |
| EST members of Unigene | CA989695 CA858026 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |