| Detail of EST/Unigene TCMT48173 |
| Acc. | TCMT48173 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=3e-57; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=4e-57; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=1e-56; Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=1e-55; Putative gamma-glutamyltranspeptidase 3 OS=Homo sapiens E-value=6e-51; |
| Length | 926 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (1 ESTs); MT_DFLOWER (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_INSECT (1 ESTs); |
| Sequence | GAAAAATGGTTTCACAGTGTCTCCTACTCTCGAAGAATACCTAGCTAATGATGAAAATAA |
| EST members of Unigene | AL378227 BQ148042 CX533706 BI266880 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
| EC | 2.3.2.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1079.1.S1_at
|
| Corresponding NCBI Gene | 829042 |
| Trichome-related Gene from Literature | 829042 |