Detail of EST/Unigene TCMT48173 |
Acc. | TCMT48173 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=3e-57; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=4e-57; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=1e-56; Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=1e-55; Putative gamma-glutamyltranspeptidase 3 OS=Homo sapiens E-value=6e-51; |
Length | 926 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (1 ESTs); MT_DFLOWER (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_INSECT (1 ESTs); |
Sequence | GAAAAATGGTTTCACAGTGTCTCCTACTCTCGAAGAATACCTAGCTAATGATGAAAATAA |
EST members of Unigene | AL378227 BQ148042 CX533706 BI266880 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
EC | 2.3.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1079.1.S1_at
|
Corresponding NCBI Gene | 829042 |
Trichome-related Gene from Literature | 829042 |