| Detail of EST/Unigene TCMT50062 |
| Acc. | TCMT50062 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 3, mitochondrial OS=Glycine max E-value=1e-28; Alternative oxidase 2, mitochondrial OS=Glycine max E-value=5e-24; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=3e-22; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=6e-16; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=1e-15; |
| Length | 258 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_UV-B (4 ESTs); |
| Sequence | TAGCGTGGTCGCGGCCGAGGTACATGATGCTTGGTCACATCTATTGACACATCTGAACTG |
| EST members of Unigene | DY632959 DY632910 DY632750 DY632672 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836542 |
| Trichome-related Gene from Literature | 836542 |