Detail of EST/Unigene TCMT51920 |
Acc. | TCMT51920 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=2e-65; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=2e-60; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=1e-19; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=3e-19; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=7e-19; |
Length | 563 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (2 ESTs); |
Sequence | GTTCAGTACAATTCCTATGGCGGAGGTGCATCTGGATTGAAGCATGTTGAAGTTCCTATT |
EST members of Unigene | BF645582 BF644447 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.6.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.39775.1.S1_at
|
Corresponding NCBI Gene | 826914 |
Trichome-related Gene from Literature | N/A |