| Detail of EST/Unigene TCMT51920 |
| Acc. | TCMT51920 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=2e-65; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=2e-60; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=1e-19; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=3e-19; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=7e-19; |
| Length | 563 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (2 ESTs); |
| Sequence | GTTCAGTACAATTCCTATGGCGGAGGTGCATCTGGATTGAAGCATGTTGAAGTTCCTATT |
| EST members of Unigene | BF645582 BF644447 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.6.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.39775.1.S1_at
|
| Corresponding NCBI Gene | 826914 |
| Trichome-related Gene from Literature | N/A |