Detail of EST/Unigene TCMT51942 |
Acc. | TCMT51942 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Zinc finger CCCH domain-containing protein 63 OS=Arabidopsis thaliana E-value=1e-73; Zinc finger CCCH domain-containing protein 48 OS=Arabidopsis thaliana E-value=4e-73; Zinc finger CCCH domain-containing protein 17 OS=Oryza sativa subsp. japonica E-value=6e-71; Zinc finger CCCH domain-containing protein 62 OS=Arabidopsis thaliana E-value=2e-68; Zinc finger CCCH domain-containing protein 59 OS=Arabidopsis thaliana E-value=1e-62; |
Length | 1205 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY (1 ESTs); MT_NOD_ROOT (1 ESTs); |
Sequence | GTCATCGAGGCTTCCATTCCCAAACATAAGACTGGAGATGAAAGATATGAGGCACAAGTC |
EST members of Unigene | DW018700 AW686738 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03362 F-box and WD-40 domain protein 1/11; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03362 F-box and WD-40 domain protein 1/11 |
EC | |
Transcription Factor Family | C3H |
Transporter Classification Family | |
Probeset |
Mtr.5097.1.S1_at
|
Corresponding NCBI Gene | 835273 |
Trichome-related Gene from Literature | N/A |