Detail of EST/Unigene TCMT54378 |
Acc. | TCMT54378 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Swertia mussotii E-value=4e-46; Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=1e-45; 7-ethoxycoumarin O-deethylase OS=Helianthus tuberosus E-value=1e-42; Cytochrome P450 76C3 OS=Arabidopsis thaliana E-value=8e-39; Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=3e-38; |
Length | 700 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (3 ESTs); MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | CTGACTTTCAAATATGGAATACTTGCCAAGTTGTATGTTCTTCCTATCTCTATTGGCATT |
EST members of Unigene | BF649539 BF646651 BF643441 CB892063 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochr |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.39010.1.S1_at
|
Corresponding NCBI Gene | 819166 |
Trichome-related Gene from Literature | N/A |