Detail of EST/Unigene TCMT55035 |
Acc. | TCMT55035 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 2E1 OS=Sus scrofa E-value=1e-06; Cytochrome P450 2C1 OS=Oryctolagus cuniculus E-value=1e-06; Cytochrome P450 71A9 OS=Glycine max E-value=3e-06; Cytochrome P450 76C3 OS=Arabidopsis thaliana E-value=4e-06; (S)-N-methylcoclaurine 3'-hydroxylase isozyme 2 OS=Eschscholzia californica E-value=5e-06; |
Length | 532 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (2 ESTs); |
Sequence | CAGANAGTAACCTTCATTTTTTCATCATTAATGTTACATTATTTCAGTATATGTTGACAG |
EST members of Unigene | BF642754 BF642544 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07415 cytochrome P450, family 2, subfamily E |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10021.1.S1_at
|
Corresponding NCBI Gene | 824463 |
Trichome-related Gene from Literature | N/A |