Detail of EST/Unigene TCMT55538 |
Acc. | TCMT55538 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase 4 OS=Arabidopsis thaliana E-value=5e-56; Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase 5 OS=Arabidopsis thaliana E-value=5e-49; 1-acyl-sn-glycerol-3-phosphate acyltransferase gamma OS=Mus musculus E-value=3e-18; 1-acyl-sn-glycerol-3-phosphate acyltransferase gamma OS=Pongo abelii E-value=7e-18; 1-acyl-sn-glycerol-3-phosphate acyltransferase gamma OS=Homo sapiens E-value=7e-18; |
Length | 700 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS (1 ESTs); MtBB_NOD (1 ESTs); |
Sequence | GCTGAAGTTGGACTTCCTGTGCTGACAAATGTACTACTTCCAAAAACAAAGGGGTTTCAC |
EST members of Unigene | BT051950 AL373469 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase |
EC | 2.3.1.51 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.38543.1.S1_at
|
Corresponding NCBI Gene | 843840 |
Trichome-related Gene from Literature | N/A |