| Detail of EST/Unigene TCMT55630 |
| Acc. | TCMT55630 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A4 OS=Solanum melongena E-value=8e-47; Cytochrome P450 71A26 OS=Arabidopsis thaliana E-value=1e-46; Cytochrome P450 71A22 OS=Arabidopsis thaliana E-value=1e-46; Cytochrome P450 71A2 OS=Solanum melongena E-value=3e-46; Cytochrome P450 71A3 (Fragment) OS=Solanum melongena E-value=5e-46; |
| Length | 847 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); |
| Sequence | ATCGACCAAGTGATATATCACGAAGAGATTGGTTTTTATCATCTGCACTCAATAGAAACC |
| EST members of Unigene | AW688786 DW016106 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450 |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.32336.1.S1_at
|
| Corresponding NCBI Gene | 823985 |
| Trichome-related Gene from Literature | N/A |