Detail of EST/Unigene TCMT58086 |
Acc. | TCMT58086 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Desiccation stress protein DSP-22, chloroplastic OS=Craterostigma plantagineum E-value=2e-12; High molecular mass early light-inducible protein HV58, chloroplastic OS=Hordeum vulgare E-value=8e-12; Carotene biosynthesis-related protein CBR, chloroplastic OS=Dunaliella bardawil E-value=8e-12; Early light-induced protein, chloroplastic OS=Pisum sativum E-value=2e-09; Low molecular mass early light-inducible protein HV60, chloroplastic OS=Hordeum vulgare E-value=9e-08; |
Length | 677 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (2 ESTs); |
Sequence | GAATCAAGCAAACACCTCCAACCAACTTTCAACTCACAACATAACCACCATGTTCACCAT |
EST members of Unigene | BG454362 BG452713 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41700.1.S1_at
|
Corresponding NCBI Gene | 821855 |
Trichome-related Gene from Literature | N/A |