Detail of EST/Unigene TCMT60949 |
Acc. | TCMT60949 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71A1 OS=Persea americana E-value=1e-24; Cytochrome P450 71D8 OS=Glycine max E-value=1e-23; Premnaspirodiene oxygenase OS=Hyoscyamus muticus E-value=1e-23; Cytochrome P450 71B2 OS=Arabidopsis thaliana E-value=1e-23; 5-epiaristolochene 1,3-dihydroxylase OS=Nicotiana tabacum E-value=2e-23; |
Length | 584 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (2 ESTs); |
Sequence | AGTTTCAAGATAATATGAGATCAACTTGGAGTTCTATATAGTCTTTATCTTCAACCTTAT |
EST members of Unigene | BG449688 BE321499 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07420 cytochrome P450, family 2, subfamily S |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.39134.1.S1_at
|
Corresponding NCBI Gene | 837865 |
Trichome-related Gene from Literature | N/A |