Detail of EST/Unigene TCMT61266 |
Acc. | TCMT61266 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Xanthine dehydrogenase 1 OS=Arabidopsis thaliana E-value=1e-74; Xanthine dehydrogenase 2 OS=Arabidopsis thaliana E-value=6e-73; Xanthine dehydrogenase OS=Oryza sativa subsp. japonica E-value=1e-69; Xanthine dehydrogenase/oxidase OS=Felis catus E-value=3e-49; Xanthine dehydrogenase/oxidase OS=Homo sapiens E-value=2e-48; |
Length | 507 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (1 ESTs); MT_Drought (1 ESTs); |
Sequence | CACTGGATTTGTCACTTGCTATCCTTGAACGTGCTATGTTTCATTCAGATAATGTGTATG |
EST members of Unigene | CX530483 BF634193 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00087 xanthine dehydrogenase; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K00106 xanthine oxidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00106 xanthine oxidase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00106 xanthine oxidase |
EC | 1.17.1.4 1.17.3.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.23395.1.S1_at
|
Corresponding NCBI Gene | 829641 |
Trichome-related Gene from Literature | N/A |