Detail of EST/Unigene TCMT61797 |
Acc. | TCMT61797 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Chlamydomonas reinhardtii E-value=1e-43; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Dunaliella tertiolecta E-value=1e-41; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Chlamydomonas moewusii E-value=7e-41; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=6e-40; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-39; |
Length | 390 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (2 ESTs); |
Sequence | CCCACACTCACCCCCCACCACATCACAATGGCCTTCGCACTCGCCACCCGCTCCCTGGCC |
EST members of Unigene | BE323566 BF637521 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.13809.1.S1_at
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |