Detail of EST/Unigene TCNB50710 |
Acc. | TCNB50710 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=0; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=0; |
Length | 935 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | |
Sequence | TTGACATCTTAAAACTAGCAATCTCTTACTTTCCTCTTGATAAACTATGGCAGCTTCTAC |
EST members of Unigene | CN744403 CN742622 CN747510 CN748096 CN742409 CN748297 CN744796 CN744018 CN744804 ES888135 CN742454 CN745601 CN741866 CN745019 CN743452 CN746138 CN747696 CN748262 ES886687 ES886368 CK294007 CK294008 CN745922 CN746315 CN748280 CN744364 CN746514 CN747098 CN746132 CN748289 CN745156 CN746298 EX534421 ES885163 CN745657 CN741724 CN744490 ES887953 CN744105 CN745085 CN745684 CN746659 CN747437 CN741756 CN742150 CN742951 CN743539 CN744865 CN655297 CN746778 CN745220 CN743066 CN746204 ES884738 CN746209 CN748365 CN746597 CN743268 ES884757 CN747779 CN655084 CN744453 CN746406 CN746793 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |