| Detail of EST/Unigene TCNT50236 |
| Acc. | TCNT50236 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Heat shock cognate 70 kDa protein 2 OS=Solanum lycopersicum E-value=0; Heat shock cognate 70 kDa protein OS=Petunia hybrida E-value=0; Probable mediator of RNA polymerase II transcription subunit 37e OS=Arabidopsis thaliana E-value=0; Probable mediator of RNA polymerase II transcription subunit 37c OS=Arabidopsis thaliana E-value=0; Heat shock cognate 70 kDa protein 1 OS=Solanum lycopersicum E-value=0; |
| Length | 2194 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | |
| Sequence | TAGTTCTCCAAAGCATTCTCTAAGCTCTCCTCTAAACTAGCCGACACTAAACAAAAGGAG |
| EST members of Unigene | FG147690 FG167165 FG626833 FG196719 FG202776 FG184542 EB434719 HO841340 FG193280 CV017508 FG141155 EB678268 FG135155 FG140835 FG143348 DV159443 FG198064 FS413193 FG140945 FG142350 FG142211 EB681019 FG153903 EB449251 FG639110 FG135763 FG162707 FG137696 FG189453 FG137699 FG142563 FG202889 FG142651 CV019262 FG168843 EH622172 FG138025 FG163559 FG144921 FG136633 FG172330 FG141635 FG143061 EH623470 EB451892 FG193696 FG135489 FG196087 FG146364 FG140371 BP130180 FG135486 EB683074 FG166337 FG143062 HO840883 FG136285 FG148542 EB678999 EB444375 FG135485 FG139392 FG138664 FG138082 FG139809 FG145148 EH620971 FG143002 FG159702 FG196958 FG145001 FG199522 EH623496 HS081037 FG163632 FG628054 EB428165 FG140573 FG138581 FG142371 HS081036 FG147740 FG149559 FG156627 FG201748 FG148241 EB445319 FG189658 FG139425 FG153839 FG146750 FG140915 FG138863 DV158779 EG649744 EB678945 FG167429 FG134920 FG156557 EB678373 EH622445 FG166399 FG167502 FG622632 FG143104 FG133257 FG166731 FG155843 FG134847 FG141948 EH623454 FG185616 EB678411 FG166799 EB451864 EH623046 FG138973 FG140123 FG202205 FG141934 EH620312 HS081568 FG145816 FG159754 FG144295 FG191578 EB441161 EB450827 FG139682 FG146622 EB440578 FG132953 FG146072 FG152249 EB432809 HS082833 FG167099 FG171772 HO842527 FG147328 FG138462 EB679101 FG138722 FG145173 EH665682 FG137017 DV161835 FG143291 FG145285 FG149485 FG150682 FG136478 FG140733 FG158391 FG626361 FG168766 FG628870 BP534824 FG155772 FG138517 EB677763 EB681068 FG135068 FG136416 FG162776 FG141818 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03283 heat shock 70kDa protein 1/8 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.3 Ryanodine-inositol-1,4,5-trisphosphate receptor Ca2+ channel RIR-CaC; 1.A.33 Cation-channel-forming heat-shock protein 70 Hsp70 |
| Probeset |
|
| Corresponding NCBI Gene | 831020 |
| Trichome-related Gene from Literature | 831020 |