Detail of EST/Unigene TCNT50238 |
Acc. | TCNT50238 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Heat shock cognate 70 kDa protein 2 OS=Solanum lycopersicum E-value=0; Heat shock cognate 70 kDa protein OS=Petunia hybrida E-value=0; Probable mediator of RNA polymerase II transcription subunit 37e OS=Arabidopsis thaliana E-value=0; Probable mediator of RNA polymerase II transcription subunit 37c OS=Arabidopsis thaliana E-value=0; Heat shock cognate 70 kDa protein 1 OS=Solanum lycopersicum E-value=0; |
Length | 2153 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | |
Sequence | TAGTTCTCCAAAGCATTCTCTAAGCTCTCCTCTAAACTAGCCGACACTAAACAAAAGGAG |
EST members of Unigene | FG193280 FG147690 FG167165 FG202776 FG184542 HO841340 FG142350 FG142211 CV017508 FG141155 FG184633 FG135155 FG140835 FG143348 DV159443 FG198064 FS413193 FG140945 FG189745 EB681019 FG627543 FG142651 EB449251 FG135763 FG628907 FG162707 FG137696 FG193371 FG189453 FG137699 FG153903 FG142563 CV019262 FG168843 FG138025 FG199613 FG163559 FG144921 FG136633 FG202889 FG172330 FG143061 EG650003 FG193696 FG135489 FG196087 FG146364 FG140371 BP130180 EB683858 EB451892 FG135486 FG166337 FG143062 HO840883 FG136285 AM847199 FG148542 EB678999 FG135485 FG139392 FG138664 FG138082 EH620971 FG143002 FG159702 FG196958 FG145001 FG199522 FG149559 FG141635 FG145148 HS082013 FG163632 FG628054 EB428165 FG140573 FG138581 FG142371 FG147740 FG139809 EB678268 FG631507 FG148241 EB445319 FG189658 FG139425 FG153839 FG146750 FG140915 FG167502 EB449133 EB435980 FG134920 FG156557 EB678373 FG643312 EB437896 FG166399 CV017021 FG138863 FG622632 FG143104 FG202980 FG166731 HS084589 FG155843 FG134847 FG141948 EH623454 FG185616 EB678411 FG133257 FG198159 FG138973 FG140123 FG202205 FG141934 EH620312 HS081568 FG145816 EB451864 FG159754 FG167099 FG146622 FG132953 FG146072 FG152249 EH665682 FG137017 FG155772 FG138517 FG139682 EB450827 FG171772 FG147328 FG138462 EB679101 FG138722 FG145173 FG197050 EB441161 EB677763 EB681068 FG135068 FG140733 FG158391 FG626361 FG144295 FG156627 EG649744 EB678945 FG167429 FG202869 FG136478 FG150682 FG136416 FG162776 FG141818 FG628870 FG168766 FG143291 FG145285 FG149485 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03283 heat shock 70kDa protein 1/8 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.3 Ryanodine-inositol-1,4,5-trisphosphate receptor Ca2+ channel RIR-CaC; 1.A.33 Cation-channel-forming heat-shock protein 70 Hsp70 |
Probeset |
|
Corresponding NCBI Gene | 831020 |
Trichome-related Gene from Literature | 831020 |