| Detail of EST/Unigene TCNT50240 |
| Acc. | TCNT50240 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Heat shock cognate 70 kDa protein 2 OS=Solanum lycopersicum E-value=0; Heat shock cognate 70 kDa protein OS=Petunia hybrida E-value=0; Probable mediator of RNA polymerase II transcription subunit 37e OS=Arabidopsis thaliana E-value=0; Probable mediator of RNA polymerase II transcription subunit 37c OS=Arabidopsis thaliana E-value=0; Heat shock cognate 70 kDa protein 1 OS=Solanum lycopersicum E-value=0; |
| Length | 2148 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | |
| Sequence | GTTCTCCGAACCATTCTCTCAGCTCTCCCCTAAACTAGCCAACACTAAACAAAAGGAGGG |
| EST members of Unigene | FG202776 HO841340 FG133655 FG142350 EB681019 FG627543 FG142651 FG167165 FG147690 CV017508 FG141155 FG184633 FG189745 FG140945 FG143348 DV159443 FG140835 CV019262 FG168843 FG138025 FG137699 FG189453 FG136562 FG193371 FG137696 FG162707 FG628907 FG135763 EB449251 FG137780 FG153903 FG142563 FG144921 FG136633 FG163559 FG199613 FG172330 FG135155 EB678268 BP130180 FG140371 FG146364 FG135489 FG193696 EG650003 EB451892 FG135486 FG135485 EB678999 FG148542 AM847199 HO840883 FG136285 FG143062 FG166337 EB683858 FG139392 FG138664 FG141635 FG149559 FG199522 FG145001 FG196958 FG143002 FG159702 EH620971 FG145148 HS082013 FG142371 FG140573 EB428165 FG628054 FG163632 FG138082 FG143061 FG167099 FG159754 FG153839 FG139425 FG146750 EB445319 FG148241 EB449133 EB435980 FG138863 CV017021 FG166399 EB437896 FG643312 EB678373 FG156557 FG134920 FG631507 FG140915 FG622632 FG143104 EB678411 EH623454 FG141948 FG134847 FG155843 HS084589 FG166731 FG133257 FG198159 EB451864 FG145816 EH620312 FG141934 FG140123 FG138973 FG202980 EB678945 FG156627 FG171772 FG155772 FG137017 FG152249 FG196632 FG146072 FG132953 FG146622 FG139682 EB450827 EB441161 FG197050 FG138722 FG145173 EB679101 FG138462 FG147328 FG138517 EB677763 EB681068 FG144295 FG201658 FG626361 FG158391 EH665898 FG140733 FG202869 FG136478 FG150682 FG149485 FG135068 FG136416 FG162776 FG141818 FG168766 FG143291 FG145285 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03283 heat shock 70kDa protein 1/8 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.3 Ryanodine-inositol-1,4,5-trisphosphate receptor Ca2+ channel RIR-CaC; 1.A.33 Cation-channel-forming heat-shock protein 70 Hsp70 |
| Probeset |
|
| Corresponding NCBI Gene | 831020 |
| Trichome-related Gene from Literature | 831020 |