Detail of EST/Unigene TCNT50787 |
Acc. | TCNT50787 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Heat shock cognate 70 kDa protein 2 OS=Solanum lycopersicum E-value=0; Heat shock cognate 70 kDa protein OS=Petunia hybrida E-value=0; Heat shock cognate 70 kDa protein 1 OS=Solanum lycopersicum E-value=0; Probable mediator of RNA polymerase II transcription subunit 37e OS=Arabidopsis thaliana E-value=0; Probable mediator of RNA polymerase II transcription subunit 37c OS=Arabidopsis thaliana E-value=0; |
Length | 2273 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | |
Sequence | AACCCTAACACAATTCTTTATTCCCTTGCTTTCTCTCCGCCGTCTTCATATTCTCTTTTT |
EST members of Unigene | FG192394 HO846990 HS082389 HO841515 FG140301 FG133060 FG176248 EH623902 EB449988 FG200094 FG201427 FG621909 FG152675 EB677297 FG144319 FG135665 FG194159 FG181345 DW003598 FG147589 EB445227 FG166092 HS085296 DV159845 EB429549 FG150896 FG199553 EB439946 DW000354 FG194472 FS409812 FG148325 FG198352 FG194071 FG134084 FG168992 FG140566 DW003527 EB442610 EB678415 FG147353 FG140467 FG198843 FG148617 FG195025 EB434470 HO842999 HO842269 FG141144 FG137404 DV159230 FG194380 HS082193 EB448021 FG138468 EB440681 FG201337 EB441654 FG137976 FG200000 FG167995 EH624035 FG166021 FG136515 HS083999 FG150811 HS083998 FG147344 EB680318 DW004834 FG623429 FG139140 FG133364 DW004436 EB450277 FG142030 FG144448 DW001773 EB682705 EB678980 FG191035 FG137124 HO842790 HO843345 EB683233 FG198754 EH624019 FG181257 FG143845 FG137569 FG137331 EB682658 EB683918 FG139786 FG135596 DV159685 FG139067 FG135758 HO842522 FG190946 FG137317 FG198262 FG136684 AM820142 FG192486 FG146427 FG133308 FG134354 FG139412 FG194932 FG152278 AM816141 FG168920 FG138518 FG137943 FG137018 FG137179 FG139874 EB682636 EB448116 EB435548 EB434958 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03283 heat shock 70kDa protein 1/8 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.3 Ryanodine-inositol-1,4,5-trisphosphate receptor Ca2+ channel RIR-CaC; 1.A.33 Cation-channel-forming heat-shock protein 70 Hsp70 |
Probeset |
|
Corresponding NCBI Gene | 831020 |
Trichome-related Gene from Literature | 831020 |