Detail of EST/Unigene TCNT50959 |
Acc. | TCNT50959 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus E-value=0; 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens E-value=0; |
Length | 1672 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | |
Sequence | CCCTTTTCCATTTCTGTGTAAAGGAAGAAGAAGAAGAAAGAAAAATGGAAAAAGCTATTG |
EST members of Unigene | FG136729 FG195778 EB438397 FG133211 FG185131 FG138093 FG132791 FG195548 FS437560 FG133252 FS382082 FG170605 FG202655 FG133772 DW001820 FG138982 FG199860 FG170539 FG193766 FG140667 FG185219 FG141539 FG135562 FS382908 FG191428 FG134163 FG134548 FG164888 FG134850 FG190161 FG155259 FG636956 FG190251 DV158190 FG186930 FG195638 FG199057 FG164826 FG184218 FG148205 FG198965 FG158995 FG187017 FG195328 FG167575 FG148281 FG165497 FG191341 FG195684 FG158934 EH618687 FG202563 FG202831 FG134908 FG202738 FG138282 FG145103 FG195419 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817876 |
Trichome-related Gene from Literature | 817876 |