Detail of EST/Unigene TCNT52883 |
Acc. | TCNT52883 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Mus musculus E-value=0; 3-ketoacyl-CoA thiolase B, peroxisomal OS=Rattus norvegicus E-value=0; |
Length | 1698 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | |
Sequence | GGAACACAAAACATATAAAGCATACCATGAAACACCAAAGCAATTCTCAAAAGTACCAAG |
EST members of Unigene | FG165036 FG198741 FG177834 FG177297 FG149129 FG637633 EB434155 FS413741 FG192634 DV161815 FG197905 FG157284 FG160487 FG175104 EB678856 FS408166 FG152297 FG162116 DV157678 FG160560 FG162054 FG153768 EB427787 FG175552 FG166440 FG625369 EB441101 FG177372 FG175625 FG189920 FG159893 FG149521 FG149063 FG169933 FG161817 EB426951 FG162515 FG197812 FG643890 FG175034 FG147437 FG151163 FG167965 FG177761 FG152223 FG198830 EB677761 FG149447 FG189830 HO842753 FG164973 FG170005 FG162441 FG159972 FG192544 FG141748 FG166504 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
EC | 2.3.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817876 |
Trichome-related Gene from Literature | 817876 |