| Detail of EST/Unigene TCNT53037 |
| Acc. | TCNT53037 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=0; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=0; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=0; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica E-value=0; |
| Length | 1612 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954 (2 ESTs); LIBEST_023330 (2 ESTs); NT_AGN_RNC (1 ESTs); |
| Sequence | CGGCCTTCGTGTTTCTCTTCATCACCTTTCACGATTCAGATCTGTTTGACCCCAAACTTC |
| EST members of Unigene | FG172332 AM832764 FG139145 FG624917 FS428351 FG133906 FG154693 FG144068 FG149536 FG166145 FG182695 FG149462 FG153064 FG628437 FG143190 FG194237 FG137293 FG623375 FG153121 X83880 FG194327 FG196836 FG182786 FG147490 FG167132 FG146629 DQ229078 DQ229077 FG147338 FG133979 FG172395 AM840190 FG143726 FG166222 FG170523 FG167201 FS431703 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
| EC | 2.7.11.24 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818982 |
| Trichome-related Gene from Literature | 818982 |