| Detail of EST/Unigene TCNT53299 |
| Acc. | TCNT53299 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L3 OS=Rattus norvegicus E-value=0; 60S ribosomal protein L3 OS=Mus musculus E-value=0; 60S ribosomal protein L3 OS=Homo sapiens E-value=0; 60S ribosomal protein L3 OS=Toxocara canis E-value=0; 60S ribosomal protein L3 OS=Bos taurus E-value=0; |
| Length | 1464 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954 (3 ESTs); |
| Sequence | GGCTGCAGCCTCCCAAAGCCGTCCCTTGCAGATTGAAGGACGAGAAAAATGTCTCATAGG |
| EST members of Unigene | FG152461 EB679257 AM799137 AM783087 FG151044 FG146906 EB442659 FG172709 FG179238 FG136992 FG169404 FG142332 FG636586 FG157886 BP533976 EG649874 FG135174 HS085303 FG143006 EB679232 FG137832 CV019187 EB444572 FG138141 FS416035 FG622054 FG178204 FG158301 FG165272 FS410195 FS431405 FG198128 FG137966 FS410002 FS395129 FG152641 AM805121 FG198032 FG182513 EB678217 EB445294 EB427112 FG166129 FG166057 FG175567 FG169156 FG158903 DW003488 FS416461 FS430082 FG198402 FG133180 FG165206 FG169084 FG198492 EB678208 HS085618 EH617145 FG175510 HS082277 FG158969 FG179330 FS377141 FG180656 FG146560 FG152578 FG182603 EB441749 FG157958 FG180570 FG172645 EB441560 EB448117 EB432548 FS395364 EB436884 FS403598 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02925 large subunit ribosomal protein L3e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842454 |
| Trichome-related Gene from Literature | 842454 |