| Detail of EST/Unigene TCNT57743 |
| Acc. | TCNT57743 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=0; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=0; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Solanum pennellii E-value=0; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Larrea tridentata E-value=0; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Larrea tridentata E-value=0; |
| Length | 1740 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_AGN_ELP (54 ESTs); NT_AGN_PNL (27 ESTs); NT_KP1BS (4 ESTs); NT_KL4B (4 ESTs); NT_TL13 (4 ESTs); NT_COL (3 ESTs); NB_BL12 (3 ESTs); NT_SL (2 ESTs); NT_KL5B (2 ESTs); NT_KF8 (1 ESTs); LIBEST_024954 (1 ESTs); |
| Sequence | GACCAACTAACTGTTGAAATTATTTTCTCAGCAAATTATAAAAGAGTTTCTAAATCAGTT |
| EST members of Unigene | FG198735 FG136329 FG194871 FG136443 FG139250 EB431904 EB437029 FG134241 FG196709 FG138536 FG199003 AM786282 FG138672 EB435112 FG140261 FG185228 EB435319 EB435904 FG132890 FG194780 FG139929 EB427829 FG138195 FG136586 DV159469 FG140135 FG198824 FG137757 FG193843 FG196622 FG133463 FG185277 EB680565 FG138227 FG137222 FG135886 FG136278 FG135294 FG191625 FG193175 FG189640 FG133141 FG193932 FG138891 FG185367 FG189728 DV162329 DV998753 FG140240 FG136131 FG185151 FG139901 DW001161 DV999901 DV161878 AM847639 FG134530 FG138393 FG191717 FG133476 AM797549 FG134348 FG185059 AM828016 FG193084 FG139500 FG137121 FG133944 FG134845 FG191822 FG197820 FG137750 EB431435 FG134247 FG140177 FS433107 FG134081 FG134374 EB437112 FG138628 FG132834 FG135379 DV159316 FG197913 FG135367 EB435929 FG134068 FG138132 FG135521 EB436276 FG136343 AM797552 FG189482 FG134574 FG185140 FG132964 FG198910 FG136479 FG138958 FG134256 FG136628 FG189571 FG132716 FG133402 FG132899 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03064 26S proteasome regulatory subunit T4 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818558 |
| Trichome-related Gene from Literature | 818558 |