| Detail of EST/Unigene TCNT58834 |
| Acc. | TCNT58834 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=0; Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=0; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=0; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=0; Mannitol dehydrogenase OS=Apium graveolens E-value=0; |
| Length | 1368 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954 (8 ESTs); NT_AGN_RNC (8 ESTs); NT_AGN_PNL (2 ESTs); NT_COL (2 ESTs); NT_AGN_RPC (1 ESTs); MT_CDS (1 ESTs); NT_LTRI3 (1 ESTs); |
| Sequence | GATCTATCTATTTCCTTATGCAATTAACTACTACTCAATTTGTTGTCATATATCTAAAAA |
| EST members of Unigene | FG153435 FG176814 AM823134 FS397252 FS431402 FS380456 FS388420 FG153499 FS434242 FG142662 FG174418 FG174487 FG176885 FG193891 FG157748 FG157808 FG193977 FS419053 FS395229 FG637661 DQ408617 FS410793 AM818757 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.1.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829955 |
| Trichome-related Gene from Literature | 829955 |